Hexokinase 2 confers radio-resistance in hepatocellular carcinoma by promoting autophagy-dependent degradation of AIMP2.

With technological advancements, radiotherapy (RT) has become an effective non-surgical treatment for hepatocellular carcinoma (HCC), comprehensively improving the local control rate of patients with HCC. However, some patients with HCC still experience radio-resistance, cancer recurrence, and distant metastasis following RT. Our previous study has revealed that hexokinase 2 (HK2), a potent oncogene, was overexpressed in radio-resistant HCC cell lines; however, its role in HCC radio-resistance remains elusive. Here, we confirmed the upregulation of HK2 in HCC tissue, which is related to unfavorable prognosis in patients with HCC, and demonstrated that HK2 exerts a radio-resistant role by attenuating apoptosis and promoting proliferation in HCC cell lines. HK2 downregulation combined with ionizing radiation showed an excellent synergistic lethal effect. Mechanistically, HK2 alleviated ionizing radiation-mediated apoptosis by complexing with pro-apoptotic protein aminoacyl tRNA synthetase complex interacting multifunctional protein 2 (AIMP2) while enhancing its autophagic lysosomal-dependent degradation, thereby increasing radio-resistance of HCC. Pharmacologically, ketoconazole, an FDA-approved antifungal drug, served as an inhibitor of HK2 and synergistically enhanced the efficacy of RT. Our results indicated that HK2 played a vital role in radio-resistance and could be a potential therapeutic target for improving RT efficacy in HCC.

Targeting MS4A4A on tumour-associated macrophages restores CD8+ T-cell-mediated antitumour immunity.

OBJECTIVE: Checkpoint immunotherapy unleashes T-cell control of tumours but is suppressed by immunosuppressive myeloid cells. The transmembrane protein MS4A4A is selectively highly expressed in tumour-associated macrophages (TAMs). Here, we aimed to reveal the role of MS4A4A+ TAMs in regulating the immune escape of tumour cells and to develop novel therapeutic strategies targeting TAMs to enhance the efficacy of immune checkpoint inhibitor (ICI) in colorectal cancer. DESIGN: The inhibitory effect of MS4A4A blockade alone or combined with ICI treatment on tumour growth was assessed using murine subcutaneous tumour or orthotopic transplanted models. The effect of MS4A4A blockade on the tumour immune microenvironment was assessed by flow cytometry and mass cytometry. RNA sequencing and western blot analysis were used to further explore the molecular mechanism by which MS4A4A promoted macrophages M2 polarisation. RESULTS: MS4A4A is selectively expressed by TAMs in different types of tumours, and was associated with adverse clinical outcome in patients with cancer. In vivo inhibition of MS4A4A and anti-MS4A4A monoclonal antibody treatment both curb tumour growth and improve the effect of ICI therapy. MS4A4A blockade treatment reshaped the tumour immune microenvironment, resulting in reducing the infiltration of M2-TAMs and exhausted T cells, and increasing the infiltration of effector CD8+ T cells. Anti-MS4A4A plus anti-programmed cell death protein 1 (PD-1) therapy remained effective in large, treatment-resistant tumours and could induce complete regression when further combined with radiotherapy. Mechanistically, MS4A4A promoted M2 polarisation of macrophages by activating PI3K/AKT pathway and JAK/STAT6 pathway. CONCLUSION: Targeting MS4A4A could enhance the ICI efficacy and represent a new anticancer immunotherapy.

KIAA1549 promotes the development and chemoresistance of colorectal cancer by upregulating ERCC2.

Colorectal cancer (CRC) is the third most commonly diagnosed cancer worldwide. Chemotherapy is the mainstay of treatment for patients with CRC in II-IV stages. Resistance to chemotherapy occurs commonly, which results in treatment failure. Therefore, the identification of novel functional biomarkers is essential for recognizing high-risk patients, predicting recurrence, and developing new therapeutic strategies. Herein, we assessed the roles of KIAA1549 in promoting tumor development and chemoresistance in colorectal cancer. As a result, we found that KIAA1549 expression is up-regulation in CRC. Public databases revealed a progressive up-regulation of KIAA1549 expression from adenomas to carcinomas. Functional characterization uncovered that KIAA1549 promotes tumor malignant phenotypes and boosts the chemoresistance of CRC cells in an ERCC2-dependent manner. Inhibition of KIAA1549 and ERCC2 effectively enhanced the sensitivity to chemotherapeutic drugs oxaliplatin and 5-fluorouracil. Our findings suggest that endogenous KIAA1549 might function as a tumor development-promoting role and trigger chemoresistance in colorectal cancer partly by upregulating DNA repair protein ERCC2. Hence, KIAA1549 could be an effective therapeutic target for CRC and inhibition of KIAA1549 combined with chemotherapy might be a potential therapeutic strategy in the future.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Polysaccharide-based biopolymer hydrogels for heavy metal detection and adsorption.

BACKGROUND: With rapid development in agriculture and industry, water polluted with heavy metallic ions has come to be a serious problem. Adsorption-based methods are simple, efficient, and broadly used to eliminate heavy metals. Conventional adsorption materials have the problems of secondary environmental contamination. Hydrogels are considered effective adsorbents, and those prepared from biopolymers are biocompatible, biodegradable, non-toxic, safe to handle, and increasingly used to adsorb heavy metal ions. AIM OF REVIEW: The natural origin and easy degradability of biopolymer hydrogels make them potential for development in environmental remediation. Its water absorption capacity enables it to efficiently adsorb various pollutants in the aqueous environment, and its internal pore channels increase the specific surface area for adsorption, which can provide abundant active binding sites for heavy metal ions through chemical modification. KEY SCIENTIFIC CONCEPT OF REVIEW: As the most representative of biopolymer hydrogels, polysaccharide-based hydrogels are diverse, physically and chemically stable, and can undergo complex chemical modifications to enhance their performance, thus exhibiting superior ability to remove contaminants. This review summarizes the preparation methods of hydrogels, followed by a discussion of the main categories and applications of polysaccharide-based biopolymer hydrogels.

Heterocyclic Suzuki-Miyaura coupling reaction of metalla-aromatics and mechanistic analysis of site selectivity.

Pd-catalyzed Suzuki-Miyaura cross-coupling is one of the most straightforward and versatile methods for the construction of functionalized arenes and heteroarenes but site-selective cross-coupling of polyhalogenated (hetero)arenes containing identical halogen substituents remains a challenging problem. Herein, we report a new candidate for heterocyclic Suzuki-Miyaura coupling reaction. This candidate has been applied in organometallic systems by combining classical aryl boronic acid reagents with non-classical heteroarenes. Experimental and computational studies of the mechanism of the reactions were performed, with an emphasis on the identity of the reactive species in the oxidative addition step and the nature of the precise site selectivity. The influence of both the aromaticity of the metalla-aromatic substrates and the steric and electronic properties of the halogenated sites are studied in detail.

A comprehensive review of nano-delivery system for tea polyphenols: Construction, applications, and challenges.

Tea polyphenols (TPs) are important bioactive compounds in tea and have excellent physiological regulation functions. However, the extraction and purification of TPs are key technologies affecting their further application, and the chemical instability, poor bioavailability of TPs are major challenges for researchers. In the past decade, therefore, research and development of advanced carrier systems for the delivery of TPs has been greatly promoted to improve their poor stability and poor bioavailability. In this review, the properties and function of TPs are introduced, and the recent advances in the extraction and purification technologies are systematically summarized. Particularly, the intelligent delivery of TPs via novel nano-carriers is critically reviewed, and the application of TPs nano-delivery system in medical field and food industry is also described. Finally, the main limitations, current challenges and future perspectives are highlighted in order to provide research ideas for exploiting nano-delivery carriers and their application in TPs.

BraVRG, a novel protein of Brassica rapa, is induced by vernalization and promotes flowering in Arabidopsis thaliana.

Plant flowering is an important economical characteristic for the transformation from vegetative growth to reproductive growth, especially for biennial crops. Additionally, bolting or flowering time is more important for vegetable plants due to their different harvest organs, such as flower for cauliflower and broccoli and leafy heads for cabbage and Chinese cabbage. The flowering time of Arabidopsis thaliana has six classical regulated pathways, and some key regulated genes are identified in Brassicaceae crops. However, the regulatory mechanism needs further exploration. Here, we reported an novel protein BraVRG (Vernalization Related Gene) of Chinese cabbage induced by vernalization. The expression of BraVRG increased rapidly at 14 day of vernalization in the semi-winter type of Brassica rapa and 21 days for the winter types. Meanwhile the modifications of H3K4me3 deposited on BraVRG increased but H3K27me3 decreased. Moreover, BraVRG promoted flowering in transgenic A. thaliana compared with the wild types accompanied the downregulated expression of FLC caused by the decrease of H3K4me3 enrichment and the increase of H3K27me3 on FLC with or without vernalization conditions.

Layered Double Hydroxide@Metal-Organic Framework Hybrids for Extraction of Indole-3-Carbinol From Cruciferous Vegetables.

Cruciferous vegetables are rich in glucosinolates, which can be metabolized to produce the antitumor compound indole-3-carbinol (I3C). The conventional solvent extraction method for I3C is inefficient. To improve the extraction efficiency of I3C from cruciferous vegetables, we prepared a metal-organic framework (MOF) material (Fe3O4@Zn-Al-LDH@B-D-MIL-100). First, Fe3O4 nanoparticles were introduced to layered double hydroxides by in situ polymerization. Then, the MOF material was grown on the surface of the layered double hydroxide by co-precipitation and the layer-by-layer self-assembly method. This gave Fe3O4@Zn-Al-LDH@B-D-MIL-100, which was characterized using a variety of techniques. The results showed that Fe3O4@Zn-Al-LDH@B-D-MIL-100 had a double-layer porous structure, excellent superparamagnetism (11.54955 emu/g), a large specific surface area (174.04 m2/g), and a pore volume (0.26 cm3/g). The extraction conditions for I3C were optimized. Non-linear fitting of the static adsorption model showed that the adsorption was mainly monolayer. Fe3O4@Zn-Al-LDH@B-D-MIL-100 had fast adsorption kinetics and could extract 95% of I3C in 45 min. It is superior to the traditional solvent extraction method because of its high enrichment efficiency in a short time and environmental friendliness. The successful preparation of the new nanomaterial will provide a new reference for the enrichment and extraction of the I3C industry.

The Carotenoid Esterification Gene BrPYP Controls Pale-Yellow Petal Color in Flowering Chinese Cabbage (Brassica rapa L. subsp. parachinensis).

Carotenoid esterification plays indispensable roles in preventing degradation and maintaining the stability of carotenoids. Although the carotenoid biosynthetic pathway has been well characterized, the molecular mechanisms underlying carotenoid esterification, especially in floral organs, remain poorly understood. In this study, we identified a natural mutant flowering Chinese cabbage (Caixin, Brassica rapa L. subsp. chinensis var. parachinensis) with visually distinguishable pale-yellow petals controlled by a single recessive gene. Transmission electron microscopy (TEM) demonstrated that the chromoplasts in the yellow petals were surrounded by more fully developed plastoglobules compared to the pale-yellow mutant. Carotenoid analyses further revealed that, compared to the pale-yellow petals, the yellow petals contained high levels of esterified carotenoids, including lutein caprate, violaxanthin dilaurate, violaxanthin-myristate-laurate, 5,6epoxy-luttein dilaurate, lutein dilaurate, and lutein laurate. Based on bulked segregation analysis and fine mapping, we subsequently identified the critical role of a phytyl ester synthase 2 protein (PALE YELLOW PETAL, BrPYP) in regulating carotenoid pigmentation in flowering Chinese cabbage petals. Compared to the yellow wild-type, a 1,148 bp deletion was identified in the promoter region of BrPYP in the pale-yellow mutant, resulting in down-regulated expression. Transgenic Arabidopsis plants harboring beta-glucuronidase (GUS) driven by yellow (BrPYP Y ::GUS) and pale-yellow type (BrPYP PY ::GUS) promoters were subsequently constructed, revealing stronger expression of BrPYP Y ::GUS both in the leaves and petals. Furthermore, virus-induced gene silencing of BrPYP significantly altered petal color from yellow to pale yellow. These findings demonstrate the molecular mechanism of carotenoid esterification, suggesting a role of phytyl ester synthase in carotenoid biosynthesis of flowering Chinese cabbage.

TXN inhibitor impedes radioresistance of colorectal cancer cells with decreased ALDH1L2 expression via TXN/NF-κB signaling pathway.

BACKGROUND: Colorectal cancer (CRC) is prevalent worldwide and is often challenged by treatment failure and recurrence due to resistance to radiotherapy. Here, we aimed to identify the elusive underlying molecular mechanisms of radioresistance in CRC. METHODS: Weighted gene co-expression network analysis was used to identify potential radiation-related genes. Colony formation and comet assays and multi-target single-hit survival and xenograft animal models were used to validate the results obtained from the bioinformatic analysis. Immunohistochemistry was performed to examine the clinical characteristics of ALDH1L2. Co-immunoprecipitation, immunofluorescence and flow cytometry were used to understand the molecular mechanisms underlying radioresistance. RESULTS: Bioinformatic analysis, in vitro, and in vivo experiments revealed that ALDH1L2 is a radiation-related gene, and a decrease in its expression induces radioresistance in CRC cells by inhibiting ROS-mediated apoptosis. Patients with low ALDH1L2 expression exhibit resistance to radiotherapy. Mechanistically, ALDH1L2 interacts with thioredoxin (TXN) and regulates the downstream NF-κB signaling pathway. PX-12, the TXN inhibitor, overcomes radioresistance due to decreased ALDH1L2. CONCLUSIONS: Our results provide valuable insights into the potential role of ALDH1L2 in CRC radiotherapy. We propose that the simultaneous application of TXN inhibitors and radiotherapy would significantly ameliorate the clinical outcomes of patients with CRC having low ALDH1L2.

First Report of Flower Stalk Wilting Caused by Rhizopus oryzae on Chinese cabbage in China.

Chinese cabbage (Brassica rapa L. ssp. pekinensis) is one of the main biennial vegetables in China and its flowers can be produced in the second year. In May 2021, approximately 50% of the flower stalks of Chinese cabbage wilted in a field in Laizhou, China. Water-soaked lesions were first observed on the lateral shoots of flower stalks, leading to wilting at a later stage. Small diseased tissues were excised from the margin of lesions, surface disinfected in 75% alcohol, rinsed in distilled water twice, and transferred onto potato dextrose agar (PDA) medium for incubation at 28 ℃. Five fungal isolates were obtained using single spore isolation method. The fungal colonies were initially white and became gray or black within 5 days. The columella was globose to subglobose and 82.86±5.25 µm (n=5) in diameter; sporangiophores were smooth-walled, simple or branched; the globose sporangia were 86.06±15.37 µm (n=5) in diameter and black; the sporangiospores were subglobose and abundant and 5.23±0.98 µm (n=5) in diameter; and the rhizoids were dark brown and 5.69±1.82 µm (n=5) wide. A cetyl tri-methyl ammonium bromide method was used to extract DNA from 3-day-old hyphae (Ausubel et al. 1987). PCR was performed for ITS (White et al. 1990), the RNA polymerase II large subunit (RPB1) gene (Voigt et al. 2000) and the actin (ACT) gene (Stiller et al. 1997). The DNA sequences of the five isolates were identical, therefore, the sequence of Isolate RO21 was submitted to GenBank. According to BLAST search, the ITS (MZ452687), RPB1 (OK431470), and ACT (OK431471) sequences showed 99.66% similarity to Rhizopus oryzae Strain CBS 112.07 (NR103595), 100% to Strain CBS 127.08 (KJ566325) and 100% to Strain CBS 102660 (KJ551423), respectively. A neighbor-joining phylogenetic tree was reconstructed based on the ITS of Isolate RO21 and 14 other Rhizopus species sequences obtained from GenBank. Isolate RO21 was found to be most closely related to R. oryzae and far from other species. Based on morphological and phylogenetic characteristics, Isolate RO21 was identified as R. oryzae (Dolatabadi et al. 2014, Kwon et al. 2015, Palemón-Alberto et al. 2020). Sporangiospores were harvested from 5-day-old PDA cultures, suspended in sterilized distilled water, adjusted to 106 spores/ml and amended with 0.1% Tween-80. Chinese cabbage inbred line "A54-1" was inoculated near the middle of the flower stalk by applying 20 µl of spore suspension (106 spores/ml) to each of three sites wounded using a sterilized knife or to the unwounded site. Sterilized distilled water was used as the control. Forty flower stalks (20 for the inoculation treatment and the rest for the control) selected from ten plants were used for pathogenicity test. All plants were incubated in a growth chamber at 28/22 °C (day/night), with 80 to 90% of relative humidity. Wilting symptoms similar to those in the field were observed in the wounded flower stalks after 5 days and in the non-wounded flower stalks after 15 days. All control flower stalks remained asymptomatic. The fungus was re-isolated from the artificially infected flower stalks and identified as R. oryzae by morphological characteristics and sequencing to fulfill the Koch's postulates. To our knowledge, this is the first report that R. oryzae causes flower stalk wilting on Chinese cabbage in China. The results can provide the basis for future studies on the occurrence, prevention and management of this disease.

Integration of glucose and cardiolipin anabolism confers radiation resistance of HCC.

BACKGROUND AND AIMS: Poor response to ionizing radiation (IR) due to resistance remains a clinical challenge. Altered metabolism represents a defining characteristic of nearly all types of cancers. However, how radioresistance is linked to metabolic reprogramming remains elusive in hepatocellular carcinoma (HCC). APPROACH AND RESULTS: Baseline radiation responsiveness of different HCC cells were identified and cells with acquired radio-resistance were generated. By performing proteomics, metabolomics, metabolic flux, and other functional studies, we depicted a metabolic phenotype that mediates radiation resistance in HCC, whereby increased glucose flux leads to glucose addiction in radioresistant HCC cells and a corresponding increase in glycerophospholipids biosynthesis to enhance the levels of cardiolipin. Accumulation of cardiolipin dampens the effectiveness of IR by inhibiting cytochrome c release to initiate apoptosis. Mechanistically, mammalian target of rapamycin complex 1 (mTORC1) signaling-mediated translational control of hypoxia inducible factor-1α (HIF-1α) and sterol regulatory element-binding protein-1 (SREBP1) remodels such metabolic cascade. Targeting mTORC1 or glucose to cardiolipin synthesis, in combination with IR, strongly diminishes tumor burden. Finally, activation of glucose metabolism predicts poor response to radiotherapy in cancer patients. CONCLUSIONS: We demonstrate a link between radiation resistance and metabolic integration and suggest that metabolically dismantling the radioresistant features of tumors may provide potential combination approaches for radiotherapy in HCC.

Advances in Research on the Mechanism of Heterosis in Plants.

Heterosis is a common biological phenomenon in nature. It substantially contributes to the biomass yield and grain yield of plants. Moreover, this phenomenon results in high economic returns in agricultural production. However, the utilization of heterosis far exceeds the level of theoretical research on this phenomenon. In this review, the recent progress in research on heterosis in plants was reviewed from the aspects of classical genetics, parental genetic distance, quantitative trait loci, transcriptomes, proteomes, epigenetics (DNA methylation, histone modification, and small RNA), and hormone regulation. A regulatory network of various heterosis-related genes under the action of different regulatory factors was summarized. This review lays a foundation for the in-depth study of the molecular and physiological aspects of this phenomenon to promote its effects on increasing the yield of agricultural production.

Development of a Joint Prediction Model Based on Both the Radiomics and Clinical Factors for Predicting the Tumor Response to Neoadjuvant Chemoradiotherapy in Patients with Locally Advanced Rectal Cancer.

PURPOSE: Neoadjuvant chemoradiotherapy (nCRT) has become the standard treatment for locally advanced rectal cancer (LARC). However, the accuracy of traditional clinical indicators in predicting tumor response is poor. Recently, radiomics based on magnetic resonance imaging (MRI) has been regarded as a promising noninvasive assessment method. The present study was conducted to develop a model to predict the pathological response by analyzing the quantitative features of MRI and clinical risk factors, which might predict the therapeutic effects in patients with LARC as accurately as possible before treatment. PATIENTS AND METHODS: A total of 82 patients with LARC were enrolled as the training cohort and internal validation cohort. The pre-CRT MRI after pretreatment was acquired to extract texture features, which was finally selected through the minimum redundancy maximum relevance (mRMR) algorithm. A support vector machine (SVM) was used as a classifier to classify different tumor responses. A joint radiomics model combined with clinical risk factors was then developed and evaluated by receiver operating characteristic (ROC) curves. External validation was performed with 107 patients from another center to evaluate the applicability of the model. RESULTS: Twenty top image texture features were extracted from 6192 extracted-radiomic features. The radiomics model based on high-spatial-resolution T2-weighted imaging (HR-T2WI) and contrast-enhanced T1-weighted imaging (T1+C) demonstrated an area under the curve (AUC) of 0.8910 (0.8114-0.9706) and 0.8938 (0.8084-0.9792), respectively. The AUC value rose to 0.9371 (0.8751-0.9997) and 0.9113 (0.8449-0.9776), respectively, when the circumferential resection margin (CRM) and carbohydrate antigen 19-9 (CA19-9) levels were incorporated. Clinical usefulness was confirmed in an external validation cohort as well (AUC, 0.6413 and 0.6818). CONCLUSION: Our study indicated that the joint radiomics prediction model combined with clinical risk factors showed good predictive ability regarding the treatment response of tumors as accurately as possible before treatment.

Genome-Wide Identification and Analysis of CC-NBS-LRR Family in Response to Downy Mildew and Black Rot in Chinese Cabbage.

The nucleotide-binding site-leucine-rich repeat (NBS-LRR) gene family is the largest group of plant disease resistance (R) genes widespread in response to viruses, bacteria, and fungi usually involved in effector triggered immunity (ETI). Forty members of the Chinese cabbage CC type NBS-LRR family were investigated in this study. Gene and protein characteristics, such as distributed locations on chromosomes and gene structures, were explored through comprehensive analysis. CC-NBS-LRR proteins were classified according to their conserved domains, and the phylogenetic relationships of CC-NBS-LRR proteins in Brassica rapa, Arabidopsis thaliana, and Oryza sativa were compared. Moreover, the roles of BrCC-NBS-LRR genes involved in pathogenesis-related defense were studied and analyzed. First, the expression profiles of BrCC-NBS-LRR genes were detected by inoculating with downy mildew and black rot pathogens. Second, sensitive and resistant Chinese cabbage inbred lines were screened by downy mildew and black rot. Finally, the differential expression levels of BrCC-NBS-LRR genes were monitored at 0, 1, 3, 6, 12 and 24 h for short and 0, 3, 5, 7, 10 and 14 days for long inoculation time. Our study provides information on BrCC-NBS-LRR genes for the investigation of the functions and mechanisms of CC-NBS-LRR genes in Chinese cabbage.

Alterations of the Gut Microbiome Composition and Lipid Metabolic Profile in Radiation Enteritis.

Radiation enteritis (RE) is a common complication in cancer patients receiving radiotherapy. Although studies have shown the changes of this disease at clinical, pathological and other levels, the dynamic characteristics of local microbiome and metabolomics are hitherto unknown. We aimed to examine the multi-omics features of the gut microecosystem, determining the functional correlation between microbiome and lipid metabolites during RE activity. By delivering single high-dose irradiation, a RE mouse model was established. High-throughput 16S rDNA sequencing and global lipidomics analysis were performed to examine microbial and lipidomic profile changes in the gut microecosystem. Spearman correlation analysis was used to determine the functional correlation between bacteria and metabolites. Clinical samples were collected to validate the above observations. During RE activity, the intestinal inflammation of the mice was confirmed by typical signs, symptoms, imaging findings and pathological evidences. 16S datasets revealed that localized irradiation dramatically altered the gut microbial composition, resulting in a decrease ratio of Bacteroidetes to Firmicutes. Lipidomics analysis indicated the remarkable lipidomic profile changes in enteric epithelial barrier, determining that glycerophospholipids metabolism was correlated to RE progression with the highest relevance. Spearman correlation analysis identified that five bacteria-metabolite pairs showed the most significant functional correlation in RE, including Alistipes-PC(36:0e), Bacteroides-DG(18:0/20:4), Dubosiella-PC(35:2), Eggerthellaceae-PC(35:6), and Escherichia-Shigella-TG(18:2/18:2/20:4). These observations were partly confirmed in human specimens. Our study provided a comprehensive description of microbiota dysbiosis and lipid metabolic disorders in RE, suggesting strategies to change local microecosystem to relieve radiation injury and maintain homeostasis.

First Report of Purple Spot on Dandelion in China Caused by Alternaria tenuissima.

Dandelion (Taraxacum mongolicum) is a perennial herb of the family Asteraceae, with a high edible and medicinal value and widely grown at medium and low altitudes in China. In July 2019, purple spot of dandelion was found in a field near Harbin City, Heilongjiang province, China. The disease incidence regionally reached 95% in fields with yield losses between 10 and 20%, seriously reducing the economic and food value of dandelion. Multiple, irregular brown spots were first observed on the leaves of this plant- that later developed into circular or near-circular purple spots with raised centers, or purple lesions along the veins. When the leaf spots coalesced, the value of the commodity was lost. To isolate the pathogen, 5 × 5 mm pieces of leaf tissue from the margins of lesions were surface disinfected in 75% alcohol, rinsed in distilled water, and incubated on potato dextrose agar (PDA) plates at 28℃ until sporulation. Using single-spore isolation, a pure culture (YY-1) was obtained with abundant grayish white hyphae that later turned olive green. The underside of the colonies were brown. Conidia were typically obclavate, had a short beak with 1 to 6, but usually 3, transverse septa, and up to 3 longitudinal septa. The transverse septum was thicker and the wall of the conidium appeared brick-like. Conidia were pale brown, catenulate, and measured from 25 to 42 µm long by 6 to 10 µm wide. YY-1 was identified as Alternaria sp. based on morphological characteristics (Simmons 2007). Molecular identification was performed to detect the fungal species, and included the Internal Transcribed Spacer (ITS), translation elongation factor 1-alpha (EF1), actin gene (ACT), plasma membrane ATPase gene (ATP), and the calmodulin gene (CAL), which were respectively amplified with primers ITS4/ITS5 (Guo et al. 2012), EF1-728F/EF1-986R (Carbone and Kohn 1999), ACT-512F/ACT-783R (Carbone and Kohn 1999), and ATPDF1/ATPDR1 and CALDF1/CALDR1 (Lawrence 2013) (GenBank Accession Nos. MN746334, MT627208, MT627209, MT558864, MT558865). The species of Alternaria could not be confirmed by sequencing the above genes, as described previously (Zheng et al. 2015). Hence, a partial coding sequence of the histone 3 gene (GenBank Accession No. MN744235) was amplified using primers H3-1a/H3-1b (Zheng et al. 2015) and it shared 98.09% sequence identity with A. tenuissima (KP267543). The ITS sequence (MN746334) was 99.81% similar to the reference sequences of A. tenuissima (KT223327) in GenBank. A Maximum-likelihood tree was then reconstructed based on the ITS, CAL, and ATP sequences by MEGA7, which showed that YY-1 was most closely related to A. tenuissima. Therefore, YY-1 was identified as A. tenuissima based on its morphological and molecular characteristics. To perform Koch's postulates, 20 healthy leaves from greenhouse-grown dandelion were inoculated with 5-µL drops of a conidial suspension (1 x 105 conidia/ml) of isolate YY-1. Sterile water was used as a control. The inoculated plants were placed in a growth chamber at 28℃ and 80 to 90% relative humidity. After 10 days, similar symptoms were observed on plants inoculated with YY-1, while control plants did not produce symptoms. The pathogen was reisolated from the inoculated leaves and identified by morphological and molecular methods as A. tenuissima. To our knowledge, this is the first report of A. tenuissima causing purple spot on T. mongolicum in China.

Mean Platelet Volume: A Novel Predictor for Bone Erosion in Gouty Arthritis?

OBJECTIVE: Gout is a type of inflammatory arthritis that can be complicated with bone erosion through several inflammatory factors. Mean platelet volume (MPV) is regarded as a marker in many inflammatory disorders, but despite this, the metric has not been used for gout. MATERIAL AND METHODS: This study evaluates the relationship between MPV and bone erosion in patients with gout. In total, 299 patients were evaluated retrospectively, and 120 patients were ultimately included based on inclusion criteria. RESULTS: Both the duration of this disease and mean platelet volume were related to bone erosion in gout and may be regarded as independent predictors of bone erosion. CONCLUSION: These results suggest that mean platelet volume can be a predictor of bone erosion in gout.

Combination of TMB and CNA Stratifies Prognostic and Predictive Responses to Immunotherapy Across Metastatic Cancer.

PURPOSE: Although tumor mutation burden (TMB) has been well known to predict the response to immune checkpoint inhibitors (ICI), lack of randomized clinical trial data has restricted its clinical application. This study aimed to explore the significance and feasibility of biomarker combination based on TMB and copy-number alteration (CNA) for the prognosis of each tumor and prediction for ICI therapy in metastatic pan-cancer milieu. EXPERIMENTAL DESIGN: Non-ICI-treated MSK pan-cancer cohort was used for prognosis analysis. Three independent immunotherapy cohorts, including non-small cell lung cancer (n = 240), skin cutaneous melanoma (n = 174), and mixed cancer (Dana-Farber, n = 98) patients from previous studies, were analyzed for efficacy of ICI therapy. RESULTS: TMB and CNA showed optimized combination for the prognosis of most metastatic cancer types, and patients with TMBlowCNAlow showed better survival. In the predictive analysis, both TMB and CNA were independent predictive factors for ICI therapy. Remarkably, when TMB and CNA were jointly analyzed, those with TMBhighCNAlow showed favorable responses to ICI therapy. Meanwhile, TMBhighCNAlow as a new biomarker showed better prediction for ICI efficacy compared with either TMB-high or CNA-low alone. Furthermore, analysis of the non-ICI-treated MSK pan-cancer cohort supported that the joint stratification of TMB and CNA can be used to categorize tumors into distinct sensitivity to ICI therapy across pan-tumors. CONCLUSIONS: The combination of TMB and CNA can jointly stratify multiple metastatic tumors into groups with different prognosis and heterogeneous clinical responses to ICI treatment. Patients with TMBhighCNAlow cancer can be an optimal subgroup for ICI therapy.